Ells were rinsed once with 2 ml of Macitentan assay medium (MEM contai…
페이지 정보
작성자 Lilla 작성일24-05-08 07:02 조회1회 댓글0건본문
Ells were rinsed once with 2 ml of assay medium (MEM containing 20 mM HEPES, pH 7.4) and incubated at 37 for 30 min with 1 ml of assay medium containing 1 mM 1-methyl-3-isobutylxanthine in the absence or presence of 50 M forskolin. The cells were lysed with 1 ml 5 trichloroacetic acid with 1 mM ATP to terminate the reaction and were stored at 4 for 1 h. Intracellular [3H]cAMP was isolated by sequential chromatography as described previously [64]. The level of [3H]cAMP was estimated by determining the ratios of [3H]cAMP to total [3H]ATP and [3H]ADP pools.Kwan et al. BMC Structural Biology (2015) 15:Page 13 ofTable 2 Primer sequences for constructing various G14/z chimerasChimera 203z14 Templates Gz/G14 G14/Gz Gz/G14 G14/Gz 182z14/14z151 Primers F: 5'- ATGGTGGACGTGGGGGGCCAACGATCGGAA -3' R: 5'- TTCCGATCGTTGGCCCCCCACGTCCACCAT -3' 14z151 F: 5'- ATGGTGGATGTTGGTGGGCAGAGGTCAGAG -3' R: 5'- CTCTGACCTCTGCCCACCAACATCCACCAT -3' 182z14 F: 5'- CGCTCCCGGGACATGACCACCGGCATCATT -3' R: 5'- ATTGATGCCGGTGGTCATGTCCCGGGAGCG -3' 14z173 F: 5'- CGCGTCCGAGTGCCCACCACGGGCATTGTG -3' R: 5'- CACAATGCCCGTGGTGGGCACTCGGACGCG -3' 1423 F: 5'- ATGGTGGATGTTGGTGGGCAGAGGTCAGAG -3' R: 5'- CTCTGACCTCTGCCCACCAACATCCACCAT -3' z23 14z173/203z14 F: 5'- ATGGTGGACGTGGGGGGCCAACGATCGGAA -3' R: 5'- TTCCGATCGTTGGCCCCCCACGTCCACCAT -3' 14z224 G14/Gz Gz/G14 131z14/Gz 14z224/G14 203z14/Gz 14z151/G14 G14/Gz Gz/G14 F: 5'- GCCATCAAGCAGCTCTGGGCCGACCCAGGG -3' R: 5'- CCCTGGGTCGGCCCAGAGCTGCTTGATGGC -3' 131z14 F: 5'- GTCATGCGACGGCTCTGGCAAGATCCAGGC -3' R: 5'- GCCTGGATCTTGCCAGAGCCGTCGCATGAC -3' 14DEF F: 5'- CGCGTCCGAGTGCCCACCACGGGCATTGTG -3' R: 5'- CACAATGCCCGTGGTGGGCACTCGGACGCG -3' zDEF F: 5'- CGCTCCCGGGACATGACCACCGGCATCATT PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/16474207 -3' R: 5'- AATGATGCCGGTGGTCATGTCCCGGGAGCG -3' 14243 F: 5'- ATGGTGGACGTGGGGGGCCAACGATCGGAA -3' R: 5'- TTCCGATCGTTGGCCCCCCACGTCCACCAT -3' z243 14N zN F: 5'- ATGGTGGATGTTGGTGGGCAGAGGTCAGAG -3' R: 5'- CTCTGACCTCTGCCCACCAACATCCACCAT -3' F: 5'- GGGCAGAGGTCAGAGCGCGAAATCAAGCTG -3' R: 5'- CAGCTTGATTTCGCGCTCTGACCTCTGCCC -3' F: 5'- AGCCAGCGGCAACGCCGTGAGCTTAAGCTG -3' R: 5'- CAGCTTAAGCTCACGGCGTTGCCGCTGGCT -3'Bold and italic nucleotides denote the G14-derived sequences. F, forward primer; R, reverse primerMolecular modelingAdditional fileAdditional file 1: Figure S1. Alignment of Gq-interacting residues in the PLC family. Figure S2. Alignment of PLC-interacting residues in the G protein family. Figure S3. Interaction of G14/Gz chimeras with Flag-TPR1. (PPTX 306 kb)Gq in a complex with PLC3 (PDB ID: 3OHM, [13]) was employed to illustrate the interaction between G and PLC, and for creating a molecular model of G14by homologous modeling using SWISS-MODEL [65, 66]. Visualization of various structures was accomplished using PyMOL (The PyMOL Molecular Graphics System, Version 1.3 Schr inger, LLC).Western blotting analysisAbbreviations AC: Adenylyl cyclase; ERK: Extracellular signal-regulated kinase; GPCRs: G protein-coupled receptors; HEK293: Human embryonic kidney 293; IP3: Inositol trisphosphate; MAPK: Mitogen-activated protein kinase; PLC: Phospholipase C; TPR1: Tetratricopeptide repeat 1. Competing interests The authors declare that they have no competing interests. Authors' contributions DHTK carried out most of the experiments and analyzed and interpreted the results. LYY performed several co-immunoprecipitation experiments. ASLC helped to design the mutant PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/9547713 constructs and KMW performed molecular model constructions and participated in drafting the manuscript. YHW conceived the study and par.
댓글목록
등록된 댓글이 없습니다.